Bai et al. Применение сальмонелл в лечении цитомегаловирусной инфекции

Oral delivery of RNase P ribozymes bySalmonella inhibits viral infection in mice

+Author Affiliations

  1. aProgram in Comparative Biochemistry, and
  2. bSchool of Public Health, University of California, Berkeley, CA 94720
  1. Edited* by Sidney Altman, Yale University, New Haven, CT, and approved January 7, 2011 (received for review October 6, 2010)

Abstract

Safe, effective, and tissue-specific delivery is a central issue for the therapeutic application of nucleic-acid-based gene interfering agents, such as ribozymes and siRNAs. In this study, we constructed a functional RNase P-based ribozyme (M1GS RNA) that targets the overlapping mRNA region of M80.5 and protease, two murine cytomegalovirus (MCMV) proteins essential for viral replication. In addition, a novel attenuated strain of Salmonella, which exhibited efficient gene transfer activity and little cytotoxicity and pathogenicity in mice, was constructed and used for delivery of anti-MCMV ribozyme. In MCMV-infected macrophages treated with the constructed attenuated Salmonella strain carrying the functional M1GS RNA construct, we observed an 80–85% reduction in the expression of M80.5/protease and a 2,500-fold reduction in viral growth. Oral inoculation of the attenuated Salmonella strain in mice efficiently delivered antiviral M1GS RNA into spleens and livers, leading to substantial expression of the ribozyme without causing significant adverse effects in the animals. Furthermore, the MCMV-infected mice that were treated orally with Salmonella carrying the functional M1GS sequence displayed reduced viral gene expression, decreased viral titers, and improved survival compared to the untreated mice or mice treated withSalmonella containing control ribozyme sequences. Our results provide direct evidence that oral delivery of M1GS RNA by Salmonella-based vectors effectively inhibits viral gene expression and replication in mice. Moreover, this study demonstrates the utility of Salmonella-mediated oral delivery of RNase P ribozyme for gene-targeting applications in vivo.

Footnotes

  • 1To whom correspondence may be addressed. E-mail: liu_fy@berkeley.edu orsangwei@berkeley.edu.
  • Author contributions: Y.B., H.G., S.L., and F.L. designed research; Y.B., H.G., H.L., G.-P.V., S.L., and F.L. performed research; Y.B., H.G., H.L., G.-P.V., and S.L. contributed new reagents/analytic tools; Y.B., H.G., S.L., and F.L. analyzed data; and Y.B., H.G., H.L., S.L., and F.L. wrote the paper.

  • The authors declare no conflict of interest.

  • *This Direct Submission article had a prearranged editor.

  • This article contains supporting information online atwww.pnas.org/lookup/suppl/doi:10.1073/pnas.1014975108/-/DCSupplemental.

Bai et al. 10.1073/pnas.1014975108
SI Materials and Methods
Viruses, Cells, and Antibodies. The Smith strain of murine cytomegalovirus
(MCMV) [American Type Culture Collection (ATCC)]
was grown in NIH3T3 cells (ATCC) or mouse J774 macrophages
(ATCC) in DMEM supplemented with 10% Nu-Serum (BD
Biosciences) as described previously (1). The antibodies against
MCMV proteins were kindly provided by Annette Meyer (Pfizer,
Inc., Ann Arbor, MI) and John Wu (Promab, Inc., Albany, CA).
The anti-mouse actin antibody was purchased from Sigma, Inc..

In Vitro Cleavage and Binding Studies of Ribozymes. 
Ribozyme
M1GS RNAs and the M80.5 mRNA substrate were synthesized
in vitro by T7 RNA polymerase (Promega) following the manufacturer’s
recommendations and further purified on 8% polyacrylamide
gels containing 8 M urea. Subsequently, the M1GS RNAs
were mixed with the [32P]-labeled mRNA substrate. The procedures
to measure the equilibrium dissociation constants (Kd) of
the M1GS-M80.5 complexes were modified from Pyle et al. (2)
and have been described previously (3). The values of Kd
obtained were the average of three experiments. The cleavage
reactions were carried out at 37 °C in a volume of 10 μL for
40 min in buffer A (50 mM Tris, pH 7.5, 100 mM NH4Cl, and
100 mM MgCl2) (3). Cleavage products were separated in denaturing
gels and quantitated with a STORM840 PhosphorImager
(Molecular Dynamics).

Construction of Salmonella Strains. 
Salmonella strain SL101 was derived from the auxotrophic 
Salmonella typhimurium aroA strain
SL7207 (a gift from Bruce A. D. Stocker, Stanford University,
CA) (4) by deleting the coding sequence of ssrA/B. The plasmid
construct pKan-clone7 was used as template to amplify the DNA
fragment to delete ssrA/B in the genome of Salmonella SL7207
by homologous targeting. Primers P5 (5′-TGTACTGCGATAGTGATCA
AGTGCCAAAGATTTTGCAACAGGCA
ACTGGAGGGAAGCATTCATATGAATATCCTCCTTAGTTC-3′) and P3
(5′-CTGCGTGGCGTAAGGCTCATCAAAATATGACCAATGCTTAATACCA
TCGGACGCCCCTGGTGTGTAGGCTGGAGCTGCTT-3′) 
were designed to amplify the kanamycin resistance
gene sequence in construct pKan-clone7. The resulting PCR products
were transformed into SL7207 carrying plasmid pKD46.
The ssrA/B deletion mutant was constructed using the λ red
recombinase method (5), following the procedures described previously
(6). The nonpolar strain SL101 was selected for its sensitivity
to kanamycin and further confirmed using PCR.

Analysis of in Vitro Growth Kinetics of Salmonella. 
Growth kinetics of Salmonella in LB broth was analyzed by first inoculating a single
colony in 2 mL LB broth and culturing at 37 °C with shaking at
250 rpm overnight (>15 h) (7). An aliquot (approximately 30 μL)
of the overnight culture was then inoculated into 3 mL fresh LB
broth and cultured at 37 °C and 250 rpm. At time points of 0, 2, 4,
6, 8, 10, 12, 14, 16, and 24 h after inoculation, an aliquot (approximately
100 μL) of bacterial culture was collected and used for
analysis by limiting dilution in 96-well plates, and then plated
on LB agar plates to determine their concentrations colony-forming
unit per milliliter. Each sample was analyzed in triplicate and
the analysis was repeated at least three times. The average value
of colongy-forming unit per milliliter was used to generate the
growth curve (7).

Northern andWestern Blot Analyses. 
The RNA and protein samples
were isolated from cells and tissues as described previously (3).
The RNA fractions were separated in 1% agarose gels that contained
formaldehyde, transferred to a nitrocellulose membrane,
hybridized with the [32P]-radiolabeled DNA probes that contained
the MCMV DNA sequence or the DNA sequence coding
for mouse mP1 RNA, and analyzed with a STORM840 PhosphorImager
(8). The DNA probes used to detect M1GS RNAs,
mouse mP1 RNA, MCMV 7.2 kb RNA transcript, and M80.5 and
PR mRNA were synthesized from plasmids pFL117, pmP1 RNA,
pM7.2KB, and pPR, respectively.
For Western blot analysis, the polypeptides from cell lysates
were separated on SDS/9% polyacrylamide gels cross-linked
with N,N′′methylenebisacylamide, transferred electrically to nitrocellulose
membranes, and stained using the antibodies against
MCMV proteins and mouse actin in the presence of a chemiluminescent
substrate (GE Healthcare) (8). The stained membranes
were analyzed with a STORM840 phosphorimager.
Quantitation was performed in the linear range of RNA and
protein detection. The levels of the mouse RNase P RNA (mP1),
MCMV 7.2 kb transcript, and mouse actin protein were used
as the internal controls in Northern and Western blot analyses,
respectively.

Analysis of the Inhibition of MCMV Growth by M1GS Ribozymes. 
To determine the level of inhibition of viral growth, 5 × 105 mouse
J774 macrophages were first treated with Salmonella carrying
different constructs at an moi of 20 bacteria per cell. At 8 h after
treatment, the Salmonella-containing cells were isolated by
FACS analysis based on GFP expression. The isolated cells were
incubated for 4 h and then either mock-infected or infected with
MCMVat an moi of one. The cells and medium were harvested
at 1, 2, 3, 4, and 5 d after infection. Viral stocks were prepared
and their titers were determined by performing plaque assays on
mouse NIH3T3 cells (8). The values obtained were the average
from triplicate experiments.

Plaque Assays to Determine the Viral Titers in Tissue Samples. 
Plaque assays were performed in NIH3T3 cells plated overnight in 6-well
cluster plates (Costar). Tenfold serial dilutions of virus samples
were inoculated onto each well of NIH3T3 cells. After 90 min
of incubation, the cells were washed with DMEM then overlaid
with DMEM containing 1% low melt agarose (Sigma). Viral
plaques were counted after 3–5 d under an inverted microscope.
Each sample was titered in triplicate, and the titer of the sample
was the average of the three values and recorded as pfu per milliliter
of organ homogenate. The limit of virus detection in the organ
homogenates was 10 pfu∕mL of the sonicated mixture. Those
samples that were negative at a 10−1 dilution were designated a
titer value of 10ð101Þ pfu∕mL.

1. Abenes G, et al. (2004) Murine cytomegalovirus with a transposon insertional
mutation at open reading frame m155 is deficient in growth and virulence in mice.
J Virol 78:6891–6899.
2. Pyle AM, McSwiggen JA, Cech TR (1990) Direct measurement of oligonucleotide
substrate binding to wild-type and mutant ribozymes from Tetrahymena. Proc Natl
Acad Sci USA 87:8187–8191.
3. Kilani AF, et al. (2000) RNase P ribozymes selected in vitro to cleave a viral mRNA
effectively inhibit its expression in cell culture. J Biol Chem 275:10611–10622.
4. Hoiseth SK, Stocker BA (1981) Aromatic-dependent Salmonella typhimurium are
non-virulent and effective as live vaccines. Nature 291:238–239.
5. Datsenko KA, Wanner BL (2000) One-step inactivation of chromosomal genes in
Escherichia coli K-12 using PCR products. Proc Natl Acad Sci USA 97:6640–6645.
Bai et al. www.pnas.org/cgi/doi/10.1073/pnas.1014975108 1 of 2
6. Lu S, Killoran PB, Fang FC, Riley LW (2002) The global regulator ArcA controls
resistance to reactive nitrogen and oxygen intermediates in Salmonella enterica
serovar Enteritidis. Infect Immun 70:451–461.
7. Su J, Gong H, Lai J, Main A, Lu S (2009) The potassium transporter Trk and external
potassium modulate Salmonella enterica protein secretion and virulence. Infect Immun
77:667–675.
8. Trang P, et al. (2000) Effective inhibition of human cytomegalovirus gene expression
and replication by a ribozyme derived from the catalytic RNA subunit of RNase P from
Escherichia coli. Proc Natl Acad Sci USA 97:5812–5817.
Bai

Ċ
Elena Luxalex,
12 февр. 2011 г., 06:13
Comments